Homocisteina y polimorfismos de cistationina [beta] sintasa y metilentetrahidrofolato reductasa en poblacion sana de Colombia

Citation metadata

Date: Jan. 1, 2006
From: Colombia Medica(Vol. 37, Issue 1.)
Publisher: Facultad de Salud-Universidad de Valle
Document Type: Article
Length: 4,312 words

Document controls

Main content

Abstract: 

Introduccion: Durante los ultimos anos la hiperhomocisteinemia moderada (>17 [micro]M) y la presencia de las variantes polimorficas de los genes comprometidos en el metabolismo de la metionina, como la cistationina [beta] sintasa (CBS) y la metilentetrahidrofolato reductasa (MTHFR), se han asociado con riesgo de enfermedad vascular.

Objetivos: Se definieron los niveles de homocisteina basales y post-carga de metionina en una poblacion de 102 personas asintomaticas, y se calcularon las frecuencias de las variantes alelicas c.699 C >T (exon 6) c.1080 C>T (exon 10) de la CBS, y de c.677 C>T (exon 1) de la MTHFR. Se estudio la asociacion entre estas variantes alelicas y la hiperhomocisteinemia.

Metodologia: La homocisteina se cuantifico en ayuno y post-carga de metionina. Se utilizo la tecnica de PCR para la amplificacion de los exones 6 y 10 de la CBS, 1 de la MTHFR y mediante analisis de restriccion, se hallaron las frecuencias alelicas de los polimorfismos c.699 C >T y c.1080 C>T, y de c.677 C>T. El estudio de asociacion se hizo mediante la prueba de [Chi.sup.2] corregido con la prueba de Fischer.

Resultados: Los niveles medio +2 DE de homocisteina fueron: basal 10.52 [micron]M+5.8 y post-carga de metionina en 30.14 + 16.20. Se identificaron 8 personas con hiperhomocisteinemia moderada, una basal y siete postcarga de metionina. La comparacion entre los valores de homocisteina post-carga de metionina en los hombres 32.43 + 8.64 y las mujeres 28.03 + 7.02 presento una diferencia significativa (p = 0.006). Estos resultados mostraron que individuos homocigotos T/T para la variante termolabil 677 de la MTHFR tienen un riesgo (Odds ratio) de 5.14 (p = 0.034) de ser hiperhomocisteinemicos.

Conclusiones: Se identificaron individuos hiperhomocisteinemicos postcarga de metionina. Se encontro asociacion entre los portadores T/T del polimorfismo c.677 de la MTHFR y la hiperhomocisteinemia. La frecuencia de portadores de este polimorfismo es la mas alta informada hasta el momento en la literatura.

Palabras clave: Hiperhomocisteinemia. Enfermedad vascular. Metilenetetrahidrofolato reductasa. Cistationina [beta] sintasa. Polimorfismos.

Homocysteine and polymorphisms of cystathionine synthase and methylentetrahydrofolate reductase in a healthy population from Colombia

Introduction: Recently, moderate hyperhomocysteinemia (>17 [micro]M) and the presence of polymorphic variants of the genes involved in methionine metabolism as cystathionine P synthase (CBS) and 5,10-methylenetetrahydrofolate reductase (MTHFR) have been associated with vascular disease.

Objectives: The aims of this study were to quantify basal and post methionine load levels of homocysteine in a Colombian healthy population and to identify the frequencies ofthe allelic variants c.699 C >T (exon 6), c.1080 C>T (exon 10) of CBS, and c.677 C>T (exon 1) of MTHFR. Association studies between these allelic variants and hiperhomocisteinemia were performed.

Methods: A group of 102 healthy individuals, without geographic origin, ethnic group or social-economic stratification were studied for polymorphisms c.699 C >T (CBS exon 6), c.1080 C>T (CBS exon 10) and c.677 C>T (MTHFR exon 1) by restriction analysis and the allele frequencies were calculated. Association study was performed using Fisher exact test.

Results: Quantification ofbasal homocysteine levels (10.52 [micro]M+5.8) and after methionine load (30.14+16, 20) was performed. Among individuals 8 were identified with moderate hyperhomocysteinemia, one having basal and the seven post methionine load. Post methionine load in males produced values of 32.43 + 8.64 and were significantly different from that offemales (p=0.006) who had values of 28.03 + 7.02. Our results showed that homozygous individuals (TT) for the 677 C/T variant have a risk of 5.14 (odds ratio, p=0.034) of being hyperhomocysteinemic.

Conclusions: Hyperhomocysteinemic patients were identified by methionine load test. A positive association-between homozygous of the polymorphism 677 of MTHFR was found. The frequency of this polymorphism in Colombia is the highest reported in the literature.

Key words: Hyperhomocysteinemia. Vascular disease. Metilenetetrahidrofolato reductasa. Cistationine [beta] sintase. Polymorphisms.

Full Text: 

La enfermedad cardiovascular es complejay multifactorial, y es la mayor causa de muerte en los paises industrializados (1). Se origina por la interaccion entre los genes y el medio pues crea un gradiente de susceptibilidad a la enfermedad. El elevado riesgo de mortalidad por enfermedad cardiovascular no se puede explicar totalmente por los factores de riesgo tradicionales como hiperlipidemia, tabaquismo e hipertension; en la actualidad, un factor independiente, la hiperhomocisteinemia, se relaciona con el desarrollo de esta enfermedad (2,3). El aumento de homocisteina se debe tanto a causas ambientales (nutricionales y el estilo de vida) como geneticas (4). Entre las causas geneticas estan las mutaciones y polimorfismos en el gen de alguna de las enzimas comprometidas en el metabolismo de la homocisteina (5).

La homocisteina es un aminoacido trombogenico, sulfurado, que se forma en el metabolismo de la metionina. La homocisteina se cataboliza a cisteina por la via de transulfuracion con la intervencion de dos enzimas dependientes de la vitamina [B.sub.6] (cistationina [beta] sintasa CBS MIM # 236200, EC 4.2.1.22 y cistationasa EC 4 41.1) o puede ser remetilada a metionina, proceso en el que interviene la enzima metilentetrahidrofolato reductasa (MTHFR) (MIM #236250, EC 1.5.1.20) dependiente del acido folico y la vitamina [B.sub.12]. Esta enzima cataliza la conversion de 5,10 metilentetrahidrofolato, en una reaccion dependiente de NADPH, a 5-metiltetrahidrofolato; este metabolito que se produce en una reaccion fisiologica irreversible, es uno de los tres dadores del grupo metilo en la conversion de homocisteina a metionina por la enzima metionina sintasa (6). Hasta el momento no se conoce con exactitud como la hiperhomocisteinemia contribuye al desarrollo de la enfermedad cardiovascular, ni cuales son los factores que desencadenan el aumento de homocisteina observado en estos pacientes. Refsum et al. (6) clasifican la hiperhomocisteinemia en moderada como la homocisteina total en plasma en el rango de (17-30 [micron]M), intermedia (30-100 ([micron]M) y severa (>100 [micron]M). Aras et al? relacionan las mutaciones sinonimas con la expresion de las enzimas y, la estabilidad del trascrito, que resulta en actividad reducida de la CBS; estos autores encontraron que los polimorfismos sinonimos del gen de la CBS (c.699 C>T en el exon 6 y c.1080 C>T en el exon 10) muestran una asociacion con hiperhomocisteinemia postcarga de metionina. Proponen que puede haber un desequilibrio de ligamiento de estos polimorfismos silentes con elementos reguladores que estimulan la trascripcion del gen de la cistationina b sintasa, para aumentar de esta forma los niveles plasmaticos de homocisteina.

Sebastio et al. (8) encontraron en pacientes con hiper-homocisteinemia severa, una mutacion en el exon 8 de la CBS, 844ins 68, consistente en una insercion de 68 pb asi: 53 pares de bases del intron 7 y 15 pares de bases del exon 8. Esta insercion produce sitos alternativos de empalme. Sin embargo, estudios posteriores de Tsai et al. (9) mostraron que la secuencia insertada se elimina a traves del empalme o <<splicing>> de la parte distal del intron 7--exon 8 y resulta asi un tamano normal de mRNA de CBS en portadores. Esta mutacion se ha investigado como factor de riesgo en la enfermedad oclusiva arterial en relacion con hiperhomocisteinemia, con resultados contradictorios; mientras Kluijtmans et al. (10) no encontraron asociacion entre este polimorfismo y la enfermedad vascular, Francis et al. (11) informan que la presencia en estado heterocigotico de la mutacion 844ins68 no es per se un factor de riesgo para el desarrollo de la enfermedad oclusiva prematura, pero cuando se encuentra en combinacion con MTHFR variante termolabil, aumenta cuatro veces el riesgo de enfermedades oclusivas por aumento del grado de hiperhomocisteinemia.

Frosst et al. (12) informaron el polimorfismo c.677 C >T en el gen de la MTHFR asociado con actividad reducida de la enzima. Brattstron et al. (13) encuentran un alza de 20% en los niveles de homocisteina plasmatica en los portadores homocigoticos de este polimorfismo.

Boers et al. (14) comunicaron que la hiperhomocisteinemia se puede descubrir por el alza en la concentracion de homocisteina en el plasma despues de carga de metionina en cerca de 30% de los pacientes con enfermedad oclusiva arterial periferica y cerebrovascular.

Se estima que en el pais aproximadamente cinco colombianos presentan un evento coronario por hora y al dia ocurren 45 muertes relacionadas con enfermedad coronaria (15); la alta frecuencia de esta enfermedad en la poblacion contribuye de una manera importante a la morbimortalidad y se constituye en un problema de salud publica. Por esta razon es necesario mejorar la identificacion de las personas en riesgo de desarrollarla como consecuencia de un aumento de homocisteina. Una primera aproximacion consiste en conocer los niveles de homocisteina basal y postcarga de metionina asi como tambien las frecuencias alelicas de los polimorfismos 844ins 68 en el exon 8, c.699 C >T en el exon 6 y c.1080 C>T en el exon 10 de la CBS, y de c.677 C>T en la MTHFR en una poblacion sin factores de riesgo tradicionales para el desarrollo de enfermedad cardiovascular. Esta estrategia permitira hacer comparaciones con pacientes que han sufrido enfermedad cardiovascular y buscar haplotipos que identifiquen personas en riesgo de desarrollar enfermedad cardiovascular.

METODOLOGIA

Poblacion. De la poblacion general, se tomo una muestra de 102 voluntarios. Se incluyeron individuos en apariencia sanos, de ambos sexos, provenientes de diversos lugares de Colombia con residencia en la ciudad de Bogota, y edades comprendidas entre 18 y 50 anos. No se estratifico por procedencia, grupo etnico, o nivel socioeconomico. Previa firma del consentimiento informado, se aplico un cuestionario con datos de historia clinica para obtener informacion sobre antecedentes familiares de enfermedades vasculares, estilo de vida, (habito de fumar, ejercicio, dieta). Se excluyeron individuos con colesterol mayor de 200 mg/dl, trigliceridos por encima de 150 mg/dl, tension arterial superior a 120/80, con niveles de glucosa menor de 70 mg/dl o mayor de 110 mg/dl. El Comite de Etica de la Facultad de Medicina de la Pontificia Universidad Javeriana, aprobo el protocolo de este estudio.

Protocolo de carga oral de metionina. Se tomo una muestra de sangre en ayuno y luego se suministro una carga oral de metionina (100 mg/kg de peso) (16), en jugo de naranja a cada una de las personas participantes en el estudio; transcurridas 4 horas, se tomo una segunda muestra de sangre (en ambos casos 5 ml en tubo seco).

Cuantificacion de homocisteina total plasmatica. La concentracion de homocisteina total plasmatica se determino con el metodo de inmunoensayo competitivo (17).

Principios biologicos del procedimiento. Este metodo (IMx de Abbott) se basa en un inmunoanalisis de polarizacion de la fluorescencia (FPIA). La homocisteina y las formas de homocisteina como disulfuro mixto y unidas a proteinas presentes en la muestra, se reducen y forman homocisteina libre al utilizar ditiotreitol (DTT). La homocisteina total libre se convierte en S-adenosil-L-homocisteina (SAH) por medio de la enzima SAH hidrolasa y exceso de adenosina. El paso posterior consiste en medir y cuantificar las moleculas de SHA por disminucion de la luz polarizada.

Analisis de polimorfismos. El ADN genomico se aislo de sangre periferica mediante el kit de purificacion de ADN (Promega, Madison, WI). Para el estudio del polimorfismo c.699C >T se amplifico el exon 6 de la CBS con los primers: forward 5' CAGCAACC CCCTGGCTCA GT 3' y 5' CAGCCATGCCCTGTGT TTGCTATT3'. Las condiciones de PCR fueron: 92[grados]C por 3 minutos 35 ciclos de (92 por 1 minuto, 64[grados]C por 1 minuto 72[grados]C por 30 segundos.) y finalmente a 72[grados]C por 7 minutos. Se obtuvo un fragmento de 289 pares de bases, al digerir con la enzima de restriccion RsaI y separar los productos en gel de poliacrilamida al 12% se obtuvieron fragmentos de 177, 92 y 20 pares de bases cuando el genotipo es C/C y, 177 y 112 pares de bases cuando el genotipo es T/T18.

Polimorfismo c.1080 C >T de la CBS. Se amplifica con los primers forward 5' CAGTGCCCACCCCAGCTCATTA 3' y reverse 5' GGCCTCCTCCCCTCCCA GTTCT 3.' Las condiciones de PCR utilizadas fueron: a 95[grados]C por 20 segundos, luego 35 ciclos de (95[grados]C por 5 segundos, 66[grados]C por 30 segundos y 68[grados]C por 40 segundos), finalmente a 68[grados]C por 10 minutos. El tamano del fragmento fue de 465 pares de bases. Al digerir con la enzima de restriccion BstUI y separar los productos en gel de poliacrilamida del 12% se observaron fragmentos de 219, 178, 68 y 20 pares de bases cuando el genotipo es C/C; el polimorfismo T hace que se pierda un punto de corte con la enzima de restriccion produciendo los fragmentos 246 y 219 (18).

Polimorfismo c.677C >T de la MTHFR. Se utilizaron los primers: forward: 5' TGAAGGAGAAGGTGTCTG CGGGA3' y reverse: 5' AGGACGGTGCGGT GAGTG 3' con las siguientes condiciones experimentales: 94[grados]C por 3 minutos; 35 ciclos (94[grados]C por 0.5 minutos, 62[grados]C por1 minuto y 72[grados]C por 30 seg.) y finalmente 72[grados]C por 7 minutos. Se obtuvo un producto de 198 pares de bases que no es cortado por la enzima de restriccion Taq I. La presencia del polimorfismo crea sitio de restriccion y se generan los fragmentos 177 y 21 pares de bases que se separaron en gel de poliacrilamida al 12% (19).

Analisis estadistico. Para descubrir la diferencia entre las concentraciones promedio de homocisteina en ayuno (basal) y post-carga de metionina en el grupo de los hombres y de las mujeres se utilizo lapruebat de Student paramuestras pareadas. Un valor de p <0.05 se considero significativo. Las diferencias entre las frecuencias del alelo raro se obtuvieron con la prueba de proporciones para muestras independientes. En el analisis estadistico de la informacion se empleo el programa STATA version 8.2. Para cuantificar la asociacion entre el genotipo c.677 C>T y el nivel de homocisteina (individuos con valores normales e individuos hiperhomocisteinemicos) se calculo el OR y un intervalo de 95% de confianza, a partir de un cuadro de cuatro casillas.

RESULTADOS

Se estudio una poblacion de 102 personas voluntarias sanas, 53 mujeres y 49 hombres. Despues de un ayuno de 12 horas, se cuantificaron los niveles de homocisteina. Estos valores se distribuyeron normalmente entre 1.0 y 22 mM (Grafica 1).

Para el calculo del valor normal de homocisteina basal se tomo como criterio la media + 2 DE de los 102 individuos, obteniendose un valor <16.32 mM. Se encontro una persona con una concentracion de homocisteina en ayunas de 21 mM, que corresponde a hiperhomocisteinemica moderada, de acuerdo con la clasificacion de Refsum et al. (6), entre la homocisteina basal de los hombres (n = 49) y mujeres (n = 53) (Cuadro 1). No se encontraron diferencias estadisticamente significativas en los niveles basales de homocisteina por sexo, luego de ajustar por edad, ejercicio, habito de fumar y dieta (p= 0.168). Luego de administrar 100 mg/kg de metionina, se encontro una diferencia significativa (p =0.006) en el aumento de homocisteina total entre hombres (32.43 + 8.64) y mujeres (28.03 + 7.02) (Cuadro 2).

Se consideraron hiperhomocisteinemicos post-carga, a las personas con valores de homocisteina X + 2 DE (>46.34 mM); con este criterio se identificaron 7 personas con valores superiores a este punto de corte. En este estudio en total se encontraron 8 individuos con hiperhomocisteinemia moderada; 7 post-carga de metionina y un individuo con hiperhomocisteinemia basal (siete hombres y una mujer).

Al comparar los valores de homocisteina basal, el delta es decir la diferencia entre el nivel de homocisteina postcarga de metionina y el nivel basal, las veces que el valor de homocisteina aumento, con el habito de fumar, el ejercicio y la dieta, no se encontraron diferencias significativas con el grupo de personas que no fuman, no hacen ejercicio ni dieta (Cuadro 3), esto puede significar que ninguna de estas variables afecta el resultado obtenido de la cuantificacion de homocisteina.

[GRAFICO 1 OMITIR]

Se analizaron los polimorfismos c.699C>T, 844 insercion 68 y c.1080 C>T de la CBS y c.677 C>T de la MTHFR. El polimorfismo 844 insercion 68 esta presente, con muy baja frecuencia (0.026), en la poblacion estudiada (Cuadro 4). Al comparar el polimorfismo c.699 C>T en el grupo de personas con hiperhomocisteinemia post-carga (homocisteina >46.34 mM) y los que muestran valores normales (homocisteina <46.34 mM) se encontro para ambos grupos que el genotipo W/W se presenta en mayor frecuencia alelica con respecto a los genotipos W/M y M/ M, mientras que en el polimorfismo c.677 C>T, el genotipo M/M corresponde a 0.71 en hiperhomocisteinemicos (homocisteina >46.34) contra 0.51 en individuos con valores normales de homocisteina (<46.34) como se muestran en los Cuadros 4 y 5 .

DISCUSION

La hiperhomocisteinemia se define como la concentracion de homocisteina total en el plasma mayor de X +2 DE en ayunas, post-carga de metionina o las dos de forma simultanea. En los ultimos anos se ha encontrado que la hiperhomocisteinemia es un factor de riesgo para el desarrollo de enfermedad vascular (20). En este estudio se identificaron ocho personas con hiperhomocisteinemia moderada, de una poblacion sana de Colombia, una de ellas por cuantificacion de la homocisteina basal y los otros siete post-carga de metionina. La concentracion de homocisteina en ayuno (basal) en la poblacion mostro una distribucion normal de frecuencia (10.52 mM + 5.8) con valores similares a los informados en la literatura (6,21). No se encontraron diferencias estadisticamente significativas en los niveles basales de homocisteina por sexo, luego de ajustar por edad, ejercicio, habito de fumar y dieta (p= 0.168).

La hiperhomocisteinemia puede tener un origen nutricional (deficiencia de vitaminas [B.sub.6], [B.sub.12] o de folato) o genetico (termolabilidad de la MTHFR o por el estado heterocigoto de la deficiencia de CBS). La hiperhomocisteinemia en ayunas se puede atribuir a una alteracion en la remetilacion de homocisteina a metionina, por deficiencia de metilenetetrahidrofolato reductasa, o de la vitamina [B.sub.12]; en estos casos no se observa hiperhomocisteinemia luego de la carga de metionina (22). En este estudio se identifico un individuo con las caracteristicas anteriormente mencionadas. El nivel promedio de homocisteina postcarga de metionina en el grupo de los hombres mostro una diferencia significativa (p = 0.006) con respecto al de las mujeres. Estos resultados indican una posible deficiencia de vitamina [B.sub.6], mayor en los hombres que en las mujeres porque cuando existe deficiencia de esta vitamina, luego de una carga de metionina se produce hiperhomocisteinemia (22). En la poblacion de hombres con homocisteina basal normal puede haber niveles bajos de vitamina [B.sub.6] mas que en las mujeres, sin embargo esta concentracion permite una buena tolerancia a la metionina de la dieta. Sin embargo, el deficit de vitamina [B.sub.6] se hace evidente cuando se somete el organismo a una sobrecarga de metionina; debido a que este aminoacido se transforma en Sadenosilmetionina, conocido inhibidor de la MTHFR y activador de la CBS, es decir la via de transulfuracion se estimula con la carga de metionina. Igualmente al comparar las veces que aumento la homocisteina luego de la carga de metionina en el grupo de hombres y de mujeres, la diferencia es significativa. La cuantificacion de vitamina [B.sub.6] en el grupo de estudio permitira evaluar si el aumento de homocisteina post-carga, se deba a una deficiencia de vitamina [B.sub.6] mayor en los hombres que en las mujeres. La estratificacion entre el habito de fumar, dieta, ejercicio e historia familiar de eventos cardiovasculares no mostro relacion con los niveles de homocisteina, en la poblacion estudiada.

Por otra parte varios estudios han informado asociacion entre el estado heterocigoto por deficiencia de la CBS con hiperhomocisteinemia moderada. Los hiperhomocisteinemicos hallados en este estudio no son portadores de la mutacion p.T191M de la CBS, mas frecuente en Colombia Bermudez et al. (23) Franchis et al. (11) relacionan la existencia del polimorfismo 844 insercion 68 con un efecto protector de hiperhomocisteinemia, esta variante genetica se encontro con muy baja frecuencia (0.026) en la poblacion estudiada. El polimorfismo c.699C>T no mostro relacion con los niveles de homocisteina, mientras el polimorfismo c.1080 C>T mostro diferencia significativa cuando se comparo la frecuencia del alelo M entre el grupo de las personas hiperhomocisteinemicas con los normales.

El polimorfismo c.677C>T responsable de la variante termolabil de la enzima metilentrahidrofolato reductasa produce una actividad reducida de esta enzima y, como consecuencia, niveles aumentados de homocisteina y asociacion con enfermedad cardiovascular (24); un elevado numero de estudios de casos y controles asocian esta variante genetica con un mayor riesgo de presentar problemas vasculares. Las frecuencias para el alelo T y el genotipo TT varian entre 0.11/0.00 en afro-americanos y 0.59/0.35 en poblacion mexicana (19). En la poblacion de estudio se observo una frecuencia para el alelo T de 0.5 comparable con (0.487) obtenido por Camacho et al. (25) en la poblacion con niveles normales de homocisteina, pues aun es mas alta (0.71) en los hiperhomocisteinemicos moderados.

Este trabajo permitio conocer los niveles basales y post-carga de homocisteina, como tambien las frecuencias alelicas de las variantes polimorficas c.699 C>T, 844 insercion 68 de la CBS y, c.677 C>T de la metilentetrahidrofolato reductasa, en una poblacion asintomatica de Colombia. Se identificaron hiperhomocisteinemicos moderados basales y, otros evidenciaron post-carga de metionina quiza por deficiencia de vitamina [B.sub.6] y adicionalmente estos individuos homocigotos T/T para la variante termolabil de la 677C>T con un riesgo (Odds ratio) de 5.14 (p = 0.034) de ser hiperhomocisteinemicos; esto puede aumentar significativamente la susceptibilidad al desarrollo de enfermedad vascular en esta poblacion.

En la poblacion asintomatica estudiada se demostro el aumento de homocisteina; para evaluar el riesgo de este aumento en la poblacion colombiana, es necesario cuantificar la homocisteina y analizar los polimorfismos estudiados en este trabajo, en pacientes egresados de las unidades de cuidados intensivos con diagnostico de infarto agudo del miocardio, en busqueda de haplotipos que identifiquen personas en riesgo de desarrollar enfermedad cardiovascular.

Recibido para publicacion mayo 31, 2005 Aceptado para publicacion enero 17, 2006

REFERENCIAS

(1.) The World Health Report 2002. Reducing risks, promoting healthy life. Geneva: WHO; 2002.

(2.) Woo KS, Chook P, Lolin YI, Cheung ASP, Chan LT, Sun YY, et al. Hyperhomocyst (e) inemia is a risk factor for arterial endothelial dysfunction in humans. Circulation 1997; 96: 2542-2544.

(3.) Graham IM, Daly LE, Refsum HM, Robinson K, Brattstrom LE, Ueland PM, et al. Plasma homocysteine as a risk factor for vascular disease. JAMA 1997; 277: 1775-1781.

(4.) Mudd D, Levy HI, Kraus JP. Disorders of transsulphuration. En: Scriver C, Beaudet A, Sly W, Valle D (eds.). The metabolic and molecular bases ofinherited disease. 8th ed. New York: McGraw Hill Inc.; 2001. p. 2007-2056.

(5.) Verhoef P, Stampfer MJ, Buring JE, Gaziano JM, Allen RH, Stabler SP, et al. Homocysteine metabolism and risk of myocardial infarction: Relation with vitamins [B.sub.6], [B.sub.12] and folate. Am J Epidemiol 1996; 143: 845-859.

(6.) Refsum H, Ueland PM, Nygard O, Vollset SE. Homocysteine and cardiovascular disease. Annu Rev Med 1998; 49: 31-62.

(7.) Aras O, Hanson NQ, Yang F, Tsai MY. Influence of 699C-T and 1080C-T polymorphisms of the cystathionine B synthase gene on plasma homocysteine levels. Clin Genet 2000; 58: 455-459.

(8.) Sebastio G, Sperandeo MP, Panico M, Francis R, Kraus JP, Andria G. The molecular basis of homocystinuria due to cystathionine b synthase deficiency in Italian families, and report of four novel mutations. Am J Hum Genet 1995; 56: 1324-1333.

(9.) Tsai MY, Bignell M, Schwichtenberg K, Hanson NQ. High prevalence ofa mutation in the cystathionine P-synthase gene. Am J Hum Genet 1996; 59: 1262-1267.

(10.) Kluijtmans LAJ, Boers GHJ, Verbruggen B, Trijbels FJM, Novakova IRO, Blom HJ. Homozygous cystathionine b synthase deficiency; combined with factor V leiden or thermolabile methylenetetrahidrofolate reductase in the risk of venous thrombosis. Blood 1996; 91: 2015-2018.

(11.) Franchis R, Fermo I, Mazzola G, Sebastio G, Di Minno G, Coppola A, etal. Contribution of the cystathionine b synthase gene (844ins68) polymorphism to the risk of early-onset venous and arterial occlusive disease and of fasting hyperhomocysteinemia. Thromb Haemost 2000; 84: 576-582.

(12.) Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, et al. A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahidrofolate reductase. Nat Genet 1995; 10: 111-113.

(13.) Brattstrom L, Israelsson B, Norrving B, Bergqvist D, Thorne J, Hultberg B, et al. Impaired homocysteine metabolism in early-onset cerebral and peripheral occlusive arterial disease. Atherosclerosis 1990; 81: 51-60.

(14.) Boers GHJ, Smals AGH, Trijbels FJM, Fowler B, Bakkeren JAJM, Schoonderwaldt HC, et al. Heterozygosity for homocystinuria in premature peripheral and cerebral occlusive arterial disease. N Engl J Med 1985; 313: 709-715.

(15.) Bohorquez R, Isaza D. Diagnostico y tratamiento del infarto agudo del miocardio. En: Texto de Cardiologia. Bogota: Sociedad Colombiana de Cardiologia; 1999. p. 450-466.

(16.) Dudman NPB, Wilcken D, Wang J, Lynch JF, Macey D, Lundberg P. Disordered methionine/homocysteine metabolism in premature vascular disease. Arterioscler Thromb 1993; 13: 1253-1260.

(17.) Shipchandler MT, Moore EG. Rapid, fully automated measurement of plasma homocyst (e) ine with the Abbott IMx analyzer. Clin Chem 1995; 41: 991-994.

(18.) Lievers KJA, Kluijtmans LAJ, Heil SG, Boers GHJ, Verhoef P, Heijer M, et al. Cystathionine B-synthase polymorphisms and hyperhomocysteinemia: an association study. Eur J Hum Genet 2003; 11: 23-29.

(19.) Mutchinick OM, Lopez MA, Luna L, Waxman J, Babinsky VE. High prevalence of the thermolabile methylenetetrahidrofolate reductase variant in Mexico: A country with a very high prevalence of neural tube defect. Mol GenetMetab 1999; 68: 461-467.

(20.) Casas JP, Bautista LE, Smeeth L, Sharma P, Hingorani AD. Homocysteine and stroke: evidence on a causal link from Mendelian randomisation. Lancet 2005; 365: 224-231.

(21.) Cordoba A., Arbelaez L, Castaneda S. Concentracion plasmatica de homocisteina en ayunas. Acta Med Colomb 2002; 27: 196-197.

(22.) Ubbink JB, Van der Merwe A, Delpot R, Allen RH, Stabler SP, Riezier R. The effect of a subnormal vitamin B-6 status on homocysteine metabolism. J Clin Invest 1996; 98: 177-184.

(23.) Bermudez M, Frank N, Bernal J, Urreizti R, Briceno I, Merinero B, et al. High prevalence of CBS p.T191M mutation in homocystinuric patients from Colombia. Hum Mutat 2006; 27: 296-303.

(24.) Kolling K, Ndrepepa G, Werner K. Methylenetetrahidrofolate reductase gene C677T and A1298 C polymorphisms, plasma homocysteine, folate, and vitamin B12 levels and the extent of coronary artery disease. Am J Cardiol 2004; 93: 1201-1205.

(25.) Camacho O, Giusti B, Restrepo CM, Abbate R, Pepe G. Frequency of factor V (FV) Leiden and C677T methylenetetrahidrofolate reductase (MTHFR) mutations in Colombians. Thromb Haemost 1998; 79: 883-884.

MARTA BERMUDEZ, BIOL. [1], IGNACIO BRICENO, M.D., PH.D. [2], FABIAN GIL, M.SC. [3], JAIME BERNAL, M.D., PH.D. [4]

* Este trabajo se hizo con el apoyo financiero de la Vicerrectoria de la Pontificia Universidad Javeriana.

[1.] Profesora, Instituto de Genetica Humana, Pontificia Universidad Javeriana y de la Universidad Colegio Mayor de Cundinamarca, Bogota, Colombia. e-mail: martha.bermudez@javeriana.edu.co

[2.] Profesor Asociado, Instituto de Genetica Humana Pontificia Universidad Javeriana, Bogota, Colombia. e-mail: ibriceno@javeriana.edu.co

[3.] Profesor, Unidad de Epidemiologia Clinica y Bioestadistica, Facultad de Medicina Pontificia Universidad Javeriana, Bogota, Colombia. e-mail: fgil@javeriana.edu.co

[4.] Profesor Titular, Director Instituto de Genetica Humana, Pontificia Universidad Javeriana, Bogota, Colombia. e-mail:jebernal@javeriana.edu.co

Cuadro 1

Comparacion de la homocisteina basal entre el grupo
de los hombres y de las mujeres

                                 Homocisteina basal
                                (hombres vs. mujeres)

                          Mujeres (n = 53)   Hombres (n = 49)

Media                          10.15              10.91
Desviacion estandar             2.61               3.09
Intervalo de confianza       9.43-10.87         10.02-11.80
p                                                  0.168

No se encontraron diferencias estadisticamente significativas en los
niveles basales de homocisteina por sexo, luego de ajustar por edad,
ejercicio, habito de fumar y dieta (p =0.168).

Cuadro 2

Comparacion de la homocisteina postcarga de
metionina entre el grupo de hombres y mujeres

Homocisteina postcarga de metionina
(hombres vs. mujeres)

                         Mujeres (n = 53)   Hombres (n = 49)

Media                          28.03             32.43
Desviacion estandar             7.02              8.64
Intervalo de confianza      26.10-29.97        29.95-34.91
p                                                0.006

Cuadro 3

Comparacion entre concentracion de homocisteina en
ayunas (basal), habito de fumar, ejercicio y dieta

            n       X (a)
                 Aumento (b)   DE (d)     IC (e)            p (f)
                  Delta (c)
Habito de
fumar

Si          34    10.64 (a)    2.1 (a)     9.91-11.38 (a)
                   2.92 (b)    0.69 (b)    2.68-3.16 (b)
                  19.95 (c)    6.85 (c)   17.56-22.34 (c)   0.75 (a)
No          68    10.45 (a)    3.19 (a)    9.68-11.23       0.50 (b)
                   3.08 (b)    1.74 (b)    2.87-3.51 (b)    0.71 (c)
                  19.44 (c)    6.47 (c)   17.87-21.00 (c)
Ejercicio

Si          43    10.28        3.15        9.31-11.25       0.42
No          23    10.91        2.64        9.76-12.05

Dieta
Si          12    10.81        2.49        9.22-12.40       0.7
No          89    10.47        2.93        9.85-11.09

(a.) Promedio de homocisteina basal

(b.) Las veces que aumentaron los niveles de homocisteina pos carga
de metionina con respecto a la homocisteina en ayuno

(c.) La diferencia entre el nivel de homocisteina pos carga de
metionina y el nivel basal de homocisteina

(d.) Desviacion estandar

(e.) Intervalo de confianza

(f.) p <0.05 significativa

Cuadro 4

Individuos con homocisteina normal postcarga de
metionina y sus respectivos genotipos

                          Genotipos observados     Frecuencia alelo

                         Homocisteina
                      <46.34 [micron]M   n =95            M

                        W/W (a)   W/M    M/M (b)

699 C>T                  58       34        3           0.21
1080 C>T                 16       23       56           0.71
844 inser 68 (c)         90        5        0          0.026
677 C>T                  22       49       24           0.51

(a.) W alelo normal

(b.) M alelo mutado

(c.) Polimorfismo que lleva el alelo 844 inser 68

Cuadro 5

Individuos hiperhomocisteinemicos postcarga con
sus respectivos genotipos

                          Genotipos observados     Frecuencia alelo

                         Homocisteina
                      <46.34 [micron]M   n =7             M

                        W/W (a)   W/M    M/M (b)

699 C>T                    4       3        0            0.42
1080 C>T                   4       1        2            0.35
844 inser 68c              7       0        0             0.0
677 C>T                    1       2        4            0.71

(a.) W alelo normal

(b.) M alelo mutado

(c.) Polimorfismo que lleva el alelo 844 inser 68

Source Citation

Source Citation   (MLA 8th Edition)
Bermudez, Marta, et al. "Homocisteina y polimorfismos de cistationina [beta] sintasa y metilentetrahidrofolato reductasa en poblacion sana de Colombia." Colombia Medica, vol. 37, no. 1, 2006, p. 46+. Gale Academic Onefile, https%3A%2F%2Flink.gale.com%2Fapps%2Fdoc%2FA281176980%2FAONE%3Fu%3Dgooglescholar%26sid%3DAONE%26xid%3Db1c2f4c7. Accessed 17 Sept. 2019.

Gale Document Number: GALE|A281176980