Polimorfismos de nucleotido simple (PNSs) del gen MC1R en alpacas negras y marrones.

Citation metadata

From: Revista peruana de biología(Vol. 28, Issue 1)
Publisher: Universidad Nacional Mayor de San Marcos
Document Type: Article
Length: 4,810 words

Document controls

Main content

Abstract: 

En alpacas los fenotipos del color de vellón tienen diferentes terminologías que induce a una confusión dentro del color marrón y sus tonalidades, el que requiere de una mejor descripción y cuantificación. En consecuencia los objetivos del estudio fueron cuantificar el color de fibra e identificar los PNSs informativos del gen MC1R (receptor 1 de melanocortina) en alpacas marrones y negras. Un fenotipo vicuña (n=14) y cuatro fenotipos de alpacas (n=79), marrón claro, marrón oscuro, marrón-negro y negro fueron evaluados por colorimetría. El vellón de vicuña mostró mayor luminosidad (47.74) e intensidad de color (24.33) respecto a las alpacas marrones. Los valores obtenidos de CIE L*a*b* (luminosidad e intensidad) sugieren valores bajos en alpacas eumelánicas y altos en alpacas feomelánicas. En vicuña y alpaca la secuencia codificante del gen MC1R tiene un solo exón de 954 pb, las vicuñas no mostraron la deleción (c.224_227del). Sin embargo, esta deleción se ha observado en los tres fenotipos de alpaca (marrón claro, marrón oscuro y negro), al igual que los cinco PNSs no sinónimos que ya fueron descritos en otras poblaciones, c.82A>G, c.259G>A, c.376G>A, c.587T>C, c.901C>T (p.T28A, p.M87V, p.G126S, p.F196S y p.R301C). Para las dos especies, se identificaron un total de ocho haplotipos definidos por los cinco PNSs. No se observaron asociaciones entre los fenotipos de color y los PNSs: c.259G>A, c.376G>A y c.901C>T (p>0.05), probablemente debido a la influencia de otros genes como el ASIP en la expresión del color. Nuestros resultados, así como los estudios previos evidenciaron regiones altamente conservadas en la secuencia codificante del gen MC1R.

Palabras clave:

fibra de alpaca; melanina; pigmentación; haplotipo; marcador genético.

In alpacas color fleece phenotypes have different terminologies that induces confusion within the brown color and its shades, it requires a better description and quantification. Consequently, the aims of the study were to quantify the color of fiber and identify the informational SNPs in the MC1R gene (melanocortin 1 receptor) in brown and black alpacas. A vicuña phenotype (n=14) and four alpaca phenotypes (n=79), light brown, dark brown, brown-black and black were evaluated by colorimetry. The vicuña fleece showed greater lightness (47.74) and color intensity (24.33) compared to brown alpacas. The CIE L*a*b* values (lightness and intensity) suggest low values in eumelanic alpacas and high in pheomelanic alpacas. In vicuña and alpaca, the coding sequence of the MC1R gene has a single exon of 954 bp, in vicuñas the deletion (c.224_227del) was not observed. However, this deletion was observed in three alpaca phenotypes (light brown, dark brown and black), as well as the five non-synonymous SNPs described in other populations, c.82A>G, c.259G>A, c.376G>A, c.587T>C, c.901C>T (p.T28A, p.M87V, p.G126S, p.F196S, and p.R301C). Eight haplotypes defined by the five SNPs were identified in both species. The associations between color phenotypes and SNPs were not observed (p>0.05), probably due to the influence of other genes such as ASIP on color expression. Our results as well as previous studies showed highly conserved regions in the coding sequence of the MC1R gene.

Key words:

alpaca fiber; melanin; pigmentation; haplotype; genetic marker.

Full Text: 

Single nucleotide polymorphisms (SNPs) of the MC1R gene in black and brown alpacas

Introducción

Después de la domesticación, la variación fenotípica del color fue una de las primeras características consideradas en la selección artificial (Cieslak et al. 2011, Linderholm y Larson 2013, Librado et al. 2017). Los genes MC1R (receptor 1 de melanocortina) y ASIP (proteína de señalización agouti) son los principales genes que intervienen en la síntesis y distribución de eumelanina y feomelanina en el vellón de alpacas (Feeley & Munyard 2009, Cieslak et al. 2011, Marín et al. 2018), pero en otros animales se han descrito más de 150 genes asociados a la expresión del color (Montoliu et al. 2011). Estudios moleculares sugieren que la domesticación de la vicuña se inició hace 6000-7000 años en los andes centrales del Perú, siendo la alpaca descendiente de la vicuña (Kadwell et al. 2001, Gentry et al. 2004, Fan et al. 2020). Posteriormente la selección de alpacas por su vellón blanco favoreció la fijación de alelos específicos en los genes MC1R y ASIP (Marín et al. 2018). La variación alélica del gen MC1R fue descrita mediante los PNSs y sus haplotipos (Powell et al. 2008, Feeley & Munyard 2009, Guridi et al. 2011, Chandramohan et al. 2015, Daverio et al. 2016).

En las últimas décadas las empresas industriales han demandado fibra blanca, favoreciendo el incremento de alpacas blancas, light fawns (LFs) y las tonalidades del marrón (Oria et al. 2009). Esta tendencia de blanqueo de la fibra conllevó a la disminución de alpacas negras y grises (Oria et al. 2009, Jones et al. 2019). Sin embargo, en algunas regiones del Perú (Apurímac, Huancavelica, Cusco, Puno y Ayacucho) se mantienen rebaños de alpacas con fibra de diversos colores (Oria et al. 2009).

En consecuencia, es necesario generar información de marcadores moleculares de tipo PNSs para la selección de animales negros y así aumentar la producción de fibra de color natural y cubrir la demanda creciente en la industria textil. Los objetivos en el presente trabajo fueron cuantificar el color de la fibra e identificar los PNSs informativos del gen MC1R en alpacas marrones y negras.

Material y métodos

Medición cuantitativa del color.--Nueve muestras de fibra de vicuña fueron obtenidas del Centro Ecológico Recreacional Taraccasa de la Municipalidad Provincial de Abancay, con autorización RDG No 270-2019-MINAGRI-SERFOR-DGGSPFFS y otras cinco muestras fueron obtenidas de vellones esquilados, procedentes del Laboratorio de Fibras Textiles--UNALM.

Los animales fueron muestreados al azar, previo un riguroso análisis de la genealogía (coancestría) de cada animal, eligiéndose a los animales que provenían de rebaños diferentes (sin evidencias de consanguinidad). Las muestras de fibra de alpaca fueron obtenidas del costillar medio de 79 animales del Fundo Pacomarca (Puno), evaluadas visualmente y registradas subjetivamente (Fig. 1), que corresponden a 22 alpacas de color café claro (CC), 19 de café oscuro marrón (COM), 11 de café oscuro negro (CON) y 27 alpacas de color negro (N). Además, para una mejor caracterización de los fenotipos de color se registró la pigmentación de ojos, mucosas, pezuñas y piel, presencia de canas y manchas.

Por otro lado, el vellón de vicuña varió de una pigmentación clara en la espalda y ligeramente más intensa en el costillar (manto). Mientras que en la parte ventral (barriga-pecho) se observó mayor proporción de cerdas blancas sin pigmentación.

Las muestras de fibra fueron lavadas antes de su medición. El equipo Chroma Meter CR-210 (Konica Minolta) se calibró con un patrón estándar según las especificaciones del manual, siguiendo el procedimiento CIE L*a*b* (CIE 2004) y posteriormente se realizaron las mediciones de L*, a*, b* en 14 vicuñas y 79 alpacas Huacaya. L* = luminosidad, a* = [saturación de color rojo (+) al verde (-)] y b* = [saturación de color amarillo (+) al azul (-)]. Adicionalmente se calculó la intensidad = [[([a.sup.*2] + [b.sup.*2]).sup.0.5]] y la tonalidad usando la función arco tangente = [[tan.sup.-1] (b*/a*)], según lo propuesto por Druml et al. (2018). Los valores obtenidos fueron registrados en el software PacoPro Versión 5.10 (http://pacomarca.com/es/programagenetico/).

Extracción de ADN.--El ADN fue extraído de 200 [micrón]L de sangre usando un kit comercial (Quick-DNA[TM] Miniprep Plus Kit). De esta manera se obtuvo el ADN genómico de 79 alpacas y dos vicuñas (control). La concentración y la calidad del ADN se determinaron por espectrofotometría con un NanoDrop 8000 en el Laboratorio de Biología Molecular y Genómica del Instituto Nacional de Innovación Agraria (INIA), Lima. La integridad se evaluó mediante electroforesis en gel de agarosa al 1% en el Instituto de Bioquímica y Biología Molecular de la Universidad Nacional Agraria La Molina.

Amplificación por reacción en cadena de polimerasa (PCR) y secuenciación del gen MC1R.--La región codificante completa del gen MC1R se amplificó mediante la técnica de PCR usando un termociclador (Mastercycler[R] flexlid-Eppendorf), con dos cebadores que incluye el directo: GCTGCGAAGTGACCAGACTC y el reverso: CTCCTCATTGCCAAGTAACTGC (Daverio et al. 2016) a una concentración de 0.20 [micrón]M.

Se empleó máster mix comercial (con Taq polimerasa) amaR OnePCR (genedirex.com/wp-content/ uploads/2018/11/SM213-0250.pdf). El perfil de ciclado incluyó tres minutos de desnaturalización inicial a 94 [grados]C, seguido de 30 ciclos: 30 segundos de desnaturalización a 94 [grados]C, 1 minuto de hibridación a 61[grados]C, 1 minuto de extensión a 72 [grados]C y una extensión final de 5 minutos a 72 [grados]C. Los productos de PCR del gen MC1R fueron purificados usando un kit comercial EnzSAP[TM] PCR Clean-up Reagent (biocat.com/bc/pdf/32-030v2_Flyer_EnzSAP_ PCR_Clean-up_Reagent.pdf), los mismos posteriormente fueron secuenciados mediante el método de Sanger en Macrogen Inc (Seoul, Korea).

Identificación de polimorfismos y genotipado.--El alineamiento de las secuencias se realizó usando el programa ClustalW (Thompson et al. 1994), para este estudio se tomó como referencia la secuencia del gen MC1R obtenida de las dos vicuñas control. Además, se consideró dos secuencias disponibles en GenBank de alpaca de color negro y marrón con número de acceso FJ502229 y FJ502230, respectivamente. El alineamiento y la identificación de polimorfismos (PNSs y deleción) se realizaron usando el software Geneious Versión 11.1.5 (https://www.geneious.com/). Los genotipos de las dos vicuñas fueron similares, mientras que las 79 secuencias de alpacas de color fueron diferentes, que resultaron del alineamiento múltiple.

Además, las dos secuencias codificantes (CDS) del gen MC1R de vicuña se compararon con 89 CDS de vicuñas (subespecie mensalis y vicugna) obtenidas por Marín et al. (2018), que incluye los números de accesos MH596180-MH596268, el alineamiento se realizó usando BLAST (Multiple Sequence Alignment Viewer 1.11.1) del servidor NCBI. Para esta comparación se tomó solamente 72 de 89 CDS reportadas por Marín et al. (2018), asumiendo el criterio del parámetro de porcentaje de similitud mayor al 99.50%. Del total de las secuencias generadas en este estudio (81 secuencias), se eligió tres secuencias representativas que corresponden a una vicuña, una alpaca marrón claro y otra alpaca negra fueron depositadas en GenBank, con los números de acceso: MW587025, MW587026 y MW587027, respectivamente.

Identificación de PNSs no sinónimos y haplotipos. Los PNSs no sinónimos resultan en la sustitución de aminoácidos. Considerando estos PNSs se predijo la estructura 2D del gen MC1R usando el software PROTTER v1.0 online tools (http://wlab.ethz.ch/protter/#). Los haplotipos fueron inferidos de los PNSs no sinónimos, para cada haplotipo se consideró una probabilidad de fase mayor a 0.9. La fase gamética de cada haplotipo fue determinada mediante el Algoritmo Bayesiano ELB usando el software Arlequín Versión 3.5.2.2 (Excoffier & Lischer 2010).

Análisis de asociación entre los PNSs no sinónimos y fenotipos de color.--La asociación de los cinco PNSs con los fenotipos de color evaluados mediante colorimetría se determinó mediante la prueba exacta de Fisher, usando el software R Versión 3.6.3 (R Core Development Team 2020).

Resultados y discusión

Caracterización cuantitativa del color.--Después del análisis cuantitativo de la fibra, el fenotipo del vellón de las vicuñas resultó diferente a lo descrito en alpacas. Los fenotipos iniciales de color evaluados visualmente en alpacas quedaron reagrupados en tres fenotipos: fenotipo 1: café claro (CC), fenotipo 2: café oscuro marrón (COM) y el fenotipo 3: incluyó el café oscuro negro (CON) y negro (N), de acuerdo con los valores de intensidad (Tabla 1).

En el vellón marrón claro de alpaca, los valores promedio de luminosidad e intensidad fueron 29.85 y 16.60, respectivamente; estos valores fueron ligeramente superiores a 27.37 y 11.41 observados en el vellón marrón oscuro de alpaca. En alpacas marrones Guridi et al. (2011) reportaron un mayor valor de luminosidad (36.25) comparado a nuestros resultados obtenidos en animales de fenotipo marrón oscuro y marrón claro. En animales negros se observó baja luminosidad entre 18.62 y 19.02, ligeramente superior a 17.23 reportado por Guridi et al. (2011). Además, en el negro se observó baja intensidad (entre 1.08 y 2.32) similar a los reportes de Lupton et al. (2006) y Guridi et al. (2011).

En este trabajo no se cuantificaron los niveles de melanina, sin embargo, los valores obtenidos de CIE L*a*b*, principalmente la luminosidad e intensidad sugieren una relación positiva con la pigmentación feomelánica (marrón claro y oscuro), por el contrario, se observó una relación inversa con la pigmentación eumelánica del animal. En ovinos, caprinos y equinos se ha indicado que la eumelanina es responsable de la pigmentación negro/ marrón y la feomelanina del rojo/amarillento (Cieslak et al. 2011). Sin embargo, Sponenberg et al. (1988) y Cecchi et al. (2007) en llamas, Cecchi et al. (2011) y Cransberg et al. (2013) en alpacas, señalaron la posible ausencia de la pigmentacion eumelánica en animales de fenotipo marrón claro. En consecuencia, no es fácil diferenciar las alpacas de fenotipo marrón con pigmentación feomelánica versus eumelánica.

El color de fibra de la vicuña mostró mayor luminosidad (47.74) e intensidad (24.33) respecto a la alpaca marrón claro, aunque sus tonalidades fueron similares (Tabla 1). El patrón de pigmentación visualmente observado en el vellón de vicuña (Vicugna vicugna mensalis) fue homogéneo, aunque la intensidad del color puede aumentar con la edad (Quispe et al. 2019). Los fenotipos de las vicuñas también fueron homogéneos, aunque Marín et al. (2018) reportaron una tonalidad más clara en las vicuñas del sur (Vicugna vicugna vicugna), que atribuyeron a la mutación no sinónima c.265A>G y dos sinónimas c.72C>G y c.618G>A.

Variación de secuencia y haplotipos en el gen MC1R.--En las vicuñas y las alpacas el gen MC1R presentó un solo exón de 954 pb, que constituye la secuencia codificante. Dentro de la secuencia codificante del gen MC1R de alpaca se observó alta variabilidad alélica, que incluye nueve PNSs y una deleción (Tabla 2). Esta deleción de 4pb (c.224_227 del) se observó en estado heterocigota en el 26.32% de los animales del fenotipo negro y 19.51% del fenotipo marrón, siendo similar a los reportes de Powell et al. (2008) y Chandramohan et al. (2015). La secuencia codificante del gen MC1R obtenida para las dos vicuñas mostró alta similitud (entre 99.58 y 100%) al comparar con las 72 secuencias de vicuña depositadas en GenBank (Marín et al. 2018). Dentro de la secuencia codificante del gen MC1R, que corresponde a las dos vicuñas, no se observó la deleción heterocigota de 4pb (c.224_227 del) similar al reporte de Marín et al. (2018).

En una muestra de las 19 alpacas marrón oscuro se observó un PNS sinónimo c.72C>G y otro no sinónimo c.265A>G (p.M89V) con genotipo heterocigota, que resulta similar a lo observado por Marín et al. (2018) en dos alpacas y las vicuñas del sur (Vicugna vicugna vicugna). Por otro lado, en alpacas marrones de Huancavelica Guridi et al. (2011) reportaron tres PNSs con sustituciones no sinónimas c.865C>T (p.C289G), c.874G>A (p.I292V) y c.886T>C (p.L296F), estos PNSs no fueron observados en la población de animales que consideramos en nuestro estudio.

De los nueve PNSs ubicados en la secuencia de codificación de MC1R (Tabla 2), cinco PNSs mostraron sustituciones no sinónimas, c.82A>G, c.259G>A, c.376G>A, c.587T>C, c.901C>T, que producen sustituciones de aminoácidos en las posiciones p.T28A, p.M87V, p.G126S, p.F196S y p.R301C, respectivamente. Estas sustituciones se encuentran localizadas en el extremo amino extracelular (p.T28A), dominios transmembrana TM2 (p.M87V), TM3 (p.G126S), TM5 (p.F196S) y el extremo carboxilo intracelular (p.R301C). Adicionalmente, se observó una nueva sustitución (p.R229C) en el tercer loop intracelular (Fig. 2), como resultado de un nuevo PNS no sinónimo c.685C>T, no incluido en la Tabla 2.

Los cuatro PNSs con sustituciones sinónimas, c.126C>T, c.354C>T, c.618G>A, c.933A>G fueron similares a los reportes de Guridi et al. (2011) y Chandramohan et al. (2015) en alpacas negras y marrones de Perú. Estos polimorfismos también fueron reportados por Powell et al. (2008) en alpacas de Estados Unidos, Feeley y Munyard (2009) y Feeley (2015) en alpacas australianas y por Daverio et al. (2016) en llamas de Argentina. Adicionalmente, en las regiones no traducidas 5'UTR y 3'UTR del gen MC1R se identificaron dos PNSs sinónimos c.-42C>G y c.*5T>C, respectivamente.

Considerando los cinco PNSs no sinónimos con una probabilidad de fase mayor de 0.9 se infirieron ocho haplotipos y sus respectivas frecuencias (Tabla 3), estos haplotipos se encuentran dentro de los 24 haplotipos teóricos analizados. El haplotipo 1: AAATC (MC1R*negro) se observó con más frecuencia en los negros (0.58) similar a lo observado por Chandramohan et al. (2015) y Daverio et al. (2016). El haplotipo 2: AGGTC (0.14) se observó en el grupo de alpacas negro y marrón, mientras que los haplotipos 3, 4 y 5 (GGGTT, GGGTC y GGGCC) solo se observaron en alpacas marrones. El haplotipo 4: GGGTC (0.07) corresponde al alelo silvestre de la vicuña (MC1R*vicuña).

Asociación entre PNSs y genotipos del gen MC1R con los fenotipos de color

Los genotipos AAATC/AAATC, AAATC/GGGCC y GGGTC/GGGTC de los cinco PNSs no sinónimos mostraron una asociación significativa (prueba exacta de Fisher p<0.001) con los fenotipos de color evaluados mediante colorimetría. Observándose mayor frecuencia del genotipo AAATC/AAATC en alpacas negra y marrón oscuro, mientras que el genotipo GGGTC/GGGTC se observó en 2 vicuñas de este estudio y 72 secuencias de vicuña reportadas por Marín et al. (2018), también este genotipo se observó en 4 muestras de 22 alpacas del fenotipo marrón claro.

Feeley y Munyard (2009) consideraron solo tres de los 5 PNSs no sinónimos, c.82A>G, c.376G>A y c.901C>T, ellos observaron el genotipo [sub.82][AA.sub.376][AA.sub.901]CC en la mayoría de las alpacas negras, siendo equivalente a nuestros hallazgos, mientras que en alpacas blancas y algunas de color light fawn ellos observaron el genotipo opuesto [sub.82][GG.sub.376][GG.sub.901]TT.

Los genotipos del PNS c.82A>G mostraron una asociación significativa con los fenotipos de color evaluados mediante colorimetría (prueba exacta de Fisher p [menor que o igual a] 0.02), aunque Powell et al. (2008) no observaron ninguna asociación. En este PNS c.82A>G se identificó una sustitución p.T28A en el extremo [N.sub.2]H de la secuencia de aminoácidos (Fig. 2), además se sabe que las sustituciones en este dominio son importantes para el funcionamiento normal de la proteína del gen MC1R (Garcia-Borron et al. 2005).

En ocho muestras de 22 alpacas marrón claro y en dos muestras de 11 alpacas marrón-negro se identificó una sustitución no sinónima c.587T>C (p.F196S) con genotipo T/C, sin embargo, el resto de las alpacas marrones y todas las alpacas negras al igual que las dos vicuñas mostraron el genotipo T/T (sin mutación) y no se observó la variante homocigota C/C en ninguno de los animales muestreados. Este polimorfismo fue también reportado por Powell et al. (2008) en alpacas de Estados Unidos y por Daverio et al. (2016) en llamas de Argentina. Considerando los genotipos T/T y T/C se observó una asociación significativa con los fenotipos de color evaluados mediante colorimetría (prueba exacta de Fisher p<0.001). Por otro lado, estudios del análisis de segregación reportados por Valbonesi et al. (2011) y Bathrachalam et al. (2019) indican que el fenotipo marrón claro sería dominante sobre el fenotipo negro.

En los otros tres PNSs, c.259G>A, c.376G>A y c.901C>T no se han observado asociaciones, probablemente debido a la presencia de heterocigotas en los tres fenotipos de color. El haplotipo constituido por los PNSs c.259G>A y c.376G>A no mostró ninguna asociación con los fenotipos de color. Para el PNS c.901C>T se observó solo dos genotipos C/C y C/T y no se observó la variante homocigota T/T en ninguno de los animales muestreados similar al reporte de Guridi et al. (2011). Por otro lado, en la mayoría de las alpacas de color blanco de otras poblaciones se ha reportado el genotipo T/T y en algunas alpacas blancas de Estados Unidos se observó la variante heterocigota (T/C) (Powell et al. 2008), asimismo en Australia (Feeley & Munyard 2009) y Perú (Chandramohan et al. 2015). Además, en el camello dromedario blanco también fueron reportados estos dos genotipos T/T y T/C (Almathen et al. 2018 y Alshanbari et al. 2019).

Inicialmente Powell et al. (2008) propusieron siete alelos para el gen MC1R, uno de ellos con pérdida de función (e) relacionado con la pigmentación feomelánica. Feeley y Munyard (2009) propusieron alelos dominantes (E) y recesivos (e). Sin embargo, se ha informado que estos alelos en combinación con los alelos del gen ASIP determinan el fenotipo negro o marrón (Chandramohan et al. 2013, Bathrachalam et al. 2019). En este estudio no se consideró la interacción epistática entre los genes MC1R y ASIP, pero se observó que un genotipo podría expresarse en más de un fenotipo o viceversa.

doi: http://dx.doi.org/10.15381/rpb.v28i1.19742

Literatura citada

Almathen F, Elbir H, Bahbahani H, et al. 2018. Polymorphisms in MC1R and ASIP genes are associated with coat color variation in the Arabian camel. Journal of Heredity 109: 700-706. https://doi:10.1093/jhered/esy024.

Alshanbari F, Castaneda C, Juras R, et al. 2019. Comparative FISH-Mapping of MC1R, ASIP, and TYRP1 in new and old world camelids and association analysis with coat color phenotypes in the dromedary (Camelus dromedarius). Frontiers in Genetics 10: 340. https://doi. org/10.3389/fgene.2019.00340.

Bathrachalam C, Nocelli C, Pazzaglia I, et al. 2019. Interaction between ASIP and MC1R in Black and Brown Alpaca. In: M Gerken, C Renieri, D Allain, H Galbraith, JP Gutiérrez, L McKenna, R Niznikowski and M. Wurzinger, ed. Advances in Fibre Production Science in South American Camelids and other Fibre Animals. Universitätsverlag Göttingen, Göttingen, Pp. 163-170.

Cecchi T, Valbonesi A, Passamonti P, et al. 2007. Quantitative variation of melanins in llama (Lama glama L.). Small Ruminant Research 71: 52-58. https://doi. org/10.1016/j.smallrumres.2006.04.011.

Cecchi T, Valbonesi A, Passamonti P, et al. 2011. Quantitative variation of melanins in alpaca (Lama pacos L.). Italian Journal of Animal Science 10: 158-161. https:// doi.org/10.4081/ijas.2011.e30.

Chandramohan B, Renieri C, La Manna V, & La Terza A. 2013. The alpaca agouti gene: genomic locus, transcripts and causative mutations of eumelanic and pheomelanic coat color. Gene 521(2): 303-310. https://doi. org/10.1016/j.gene.2013.03.060.

Chandramohan B, Renieri C, La Manna V, & La Terza A. 2015. The alpaca melanocortin 1 receptor: gene mutations, transcripts, and relative levels of expression in ventral skin biopsies. The Scientific World Journal 1-9. http:// dx.doi.org/10.1155/2015/265751.

Cieslak M, Reissmann M, Hofreiter M, & Ludwig A. 2011. Colours of domestication. Biological Reviews 86 (4): 885-899. https://doi.org/10.1111/j.1469-185X.2011.00177.x.

CIE (Commission International de I'Eclerage). 2004. CIE 15: Technical Report: Colorimetry. 3. ed. Commission Internationale de l'Eclairage. Washington, The United States of America.

Cransberg R, Wakamatsu K, & Munyard K. 2013. Melanin characterization suggests that the "brown" phenotype in alpaca (Vicugna pacos) is predominantly pheomelanic. Small Ruminant Research 114: 240-246. http:// dx.doi.org/10.1016/j.smallrumres.2013.07.004.

Daverio MS, Rigalt F, Romero SR, et al. 2016. Polymorphisms in MC1R and ASIP genes and its association with coat color phenotypes in llamas (Lama glama). Small Ruminant Research 144: 83-89. http://dx.doi. org/10.1016/j.smallrumres.2016.08.003.

Druml T, Grilz-Seger G, Horna M, & Brem G. 2018. Discriminant analysis of colour measurements reveals allele dosage effect of ASIP/MC1R in bay horses. Czech Journal of Animal Science 63: 347-355. https://doi. org/10.17221/105/2017-CJAS.

Excoffier L, & Lischer HEL. 2010. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10: 564-567. https://doi.org/10.1111/ j.1755-0998.2010.02847.x.

Fan R, Gu Z, Guang X, et al. 2020. Genomic analysis of the domestication and post-Spanish conquest evolution of the llama and alpaca. Genome Biology 21(159): 1-26. https://doi.org/10.1186/s13059-020-02080-6.

Feeley NL, & Munyard KA. 2009. Characterization of the melanocortin 1 receptor gene in alpaca and identification of possible markers associated with phenotypic variations in colour. Animal Production Science 49: 675-681. https://doi.org/10.1071/AN09005

Feeley N.L. 2015. Inheritance of fibre color in Alpacas: identifying the genes involved. Thesis of Ph.D of Curtin University. 178p. http://hdl.handle.net/20.500.11937/26

Garcia-Borron JC, Sanchez BL, & Jimenez-Cervantes C. 2005. Melanocortin 1 receptor structure and functional regulation. Pigment Cell Research 18: 393-410. https:// doi.org/10.1111/j.1600-0749.2005.00278.x.

Gentry A, Clutton-Brock J, & Groves CP. 2004. The naming of wild animal species and their domestic derivatives. Journal Archaeological Science 31: 645-651. doi: 10.1016/j.jas.2003.10.006.

Guridi M, Soret B, Alfonso L, & Arana A. 2011. Single nucleotide polymorphisms in the melanocortin 1 receptor gene are linked with lightness of fibre colour in Peruvian Alpaca (Vicugna pacos). Animal Genetics 42(6): 679-82. https://doi.org/10.1111/j.1365-2052.2011.02205.x.

Jones M, Sergeant C, Richardson M, et al. 2019. A non-synonymous PNS in exon 3 of the KIT gene is responsible for the classic grey phenotype in alpacas (Vicugna pacos). Animal Genetics 50(5): 493-500. https://doi. org/10.1111/age.12814.

Kadwell M, Fernández M, Stanley H, et al. 2001. Genetic analysis reveals the wild ancestors of the llama and alpaca. Proceedings of Royal Society of London 268: 2575-2584. https://doi.org/10.1098/rspb.2001.1774.

Librado P, Gamba C, Gaunitz C, et al. 2017. Ancient genomic changes associated with domestication of the horse. Science 356 (6336): 442-445. doi: 10.1126/science. aam5298.

Linderholm A, & Larson G. 2013. The role of humans in facilitating and sustaining coat colour variation in domestic animals. Seminar in Cell & Developmental Biology 24: 587-593. http://dx.doi.org/10.1016/j. semcdb.2013.03.015.

Lupton CJ, McColl A, & Stobart RH. 2006. Fiber characteristics of the Huacaya alpaca. Small Ruminant Research 64: 211-224. https://doi.org/10.1016/j.smallrumres.2005.04.023.

Marín JC, Rivera R, Varas V, et al. 2018. Genetic variation in coat colour genes MC1R and ASIP provides insights into domestication and management of South American camelids. Frontiers in Genetics 9:487-494. https:// doi.org/10.3389/fgene.2018.00487.

Montoliu L, Oetting WS, & Bennett DC. 2011. Color Genes. International Federation of Pigment Cell Societies. http:// www.espcr.org/micemut. [Acceso 2020 marzo 31].

Oria I, Quicaño I, Quispe EC, & Alfonso L. 2009. Variabilidad del color de la fibra de alpaca en la zona altoandina de Huancavelica-Perú. Animal Genetic Resources Information 45: 79-84. https://doi.org/10.1017/ S101423390999037X.

Powell AJ, Moss MJ, Tree LT, et al. 2008. Melanocortin 1 receptor, a member of the hair color genetic locus, in alpaca (Lama pacos) fleece color differentiation. Small Ruminant Research 79: 183-187. https://doi. org/10.1016/j.smallrumres.2008.07.025"

Quispe JE, Bustinza V, & Jahuira F. 2019. Características del vellón de vicuñas (Vicugna vicugna mensalis) de Cala Cala y Picotani (Puno-Perú) criadas en semicautiverio. Revista de Investigaciones Veterinarias del Perú 30 (2): 523-536. https://dx.doi.org/10.15381/rivep. v30i2.16090.

Valbonesi A, Apaza N, La Manna V, et al. 2011. Inheritance of white, black and brown coat colours in alpaca (Vicuna pacos L.). Small Ruminant Research 99: 16-19. https://doi.org/10.1016/j.smallrumres.2011.04.003.

R Core Team. 2020. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org/.

Sponenberg DP, Ito S, Wakamatsu K, & Eng LA. 1998. Pigment types in sheep, goats, and llamas. Pigment Cell Research 1(6): 414-8. doi: 10.1111/j.1600-0749.1988. tb00145.x.

Thompson JD, Higgins DG, & Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weightmatrix choice. Nucleic Acids Research 22: 4673-4680. https://doi. org/10.1093/nar/22.22.4673.

Agradecimientos / Acknowledgments:

Los autores agradecen a los colaboradores: Centro Ecológico Recreacional Taraccasa-Municipalidad Provincial de Abancay por aceptar y autorizar la colección del material genético de 9 vicuñas (RDG No 270-2019-MINAGRI-SERFOR-DGGSPFFS). Programa de Investigación y Proyección Social en Ovinos y Camélidos Americanos (POCA). Laboratorio de Fibras Textiles de la Universidad Nacional Agraria La Molina. MVZ. Alex Yucra por su contribución en la cuantificación del color de fibra.

Conflicto de intereses / Competing interests:

Los autores no incurren en conflictos de intereses.

Rol de los autores / Authors Roles:

RP: participó en la redacción del manuscrito, concepción del diseño, cuantificación del color de fibra, obtención de los datos, análisis bioinformático y estadístico. FDR, MSD: Contribución a la concepción y al diseño del trabajo, orientaron el análisis bioinformático, revisaron y aprobaron el manuscrito. FAPL, GAG, AC, JPG, MW: orientaron el diseño inicial de la investigación, revisión crítica del trabajo y la aprobación final del manuscrito.

Fuentes de financiamiento / Funding:

El presente trabajo es parte del proyecto: Caracterización, mejoramiento genético y conservación de los recursos genéticos de animales en el Perú. Convenio de financiamiento No 178-2015-FONDECYT.

Aspectos éticos / legales; Ethics / legals:

La colección de muestras biológicas se realizó cumpliendo con los estándares de bienestar animal, así como lo indicado en la RDG No 270-2019-MINAGRI-SERFOR-DGGSPFFS.

Presentado: 28/05/2020

Aceptado: 14/01/2021

Publicado online: 25/02/2021

Editor: Rina Ramírez

Autores

Rubén Pinares * (1, 8)

zoovet_p@hotmail.com

https://orcid.org/0000-0002-9033-7736

Alan Cruz (1, 2)

alancruzc@outlook.com

https://orcid.org/0000-0002-9462-4986

María Silvana Daverio (3, 4),

m.sil.daverio@outlook.com

Juan Pablo Gutiérrez (5)

gutgar@vet.ucm.es

https://orcid.org/0000-0001-8514-4158

Federico Abel Ponce de León (6)

apl@umn.edu

https://orcid.org/0000-0001-8645-553X

María Wurzinger (1, 7)

maria.wurzinger@boku.ac.at

https://orcid.org/0000-0001-9391-014X

Florencia Di Rocco (3)

fdirocco@imbice.gov. ar

Gustavo Augusto Gutiérrez (1)

gustavogr@lamolina.edu.pe

https://orcid.org/0000-0002-1896-0048

Correspondencia

* Corresponding author

(1) Universidad Nacional Agraria La Molina, Escuela de Posgrado, Doctorado en Ciencia Animal. Av. La Molina s/n, Lima, Perú.

(2) Fundo Pacomarca, Inca Tops S.A. Av. Miguel Forga 348, Arequipa, Perú.

(3) Instituto Multidisciplinario de Biología Celular. Calle 526 e/10 y 11, La Plata 1900, Buenos Aires, Argentina.

(4) Universidad Nacional de La Plata, Facultad de Ciencias Exactas, Departamento de Ciencias Biológicas. Calle 115 y 47. (CP 1900), La Plata, Buenos Aires, Argentina.

(5) Universidad Complutense de Madrid, Departamento de producción Animal. Av. Puerta de Hierro s/n E-28040, Madrid, España.

(6) University of Minnesota, St. Paul, MN 55108, United States.

(7) University of Natural Resources and Life Sciences Vienna, Department of Sustainable Agricultural System, Division of Livestock Sciences, Gregor-Mendel Strasse 33, A-1180 Vienna, Austria.

(8) Universidad Nacional Micaela Bastidas de Apurímac, Facultad de Medicina Veterinaria y Zootecnia. Calle Los Álamos y Los Lirios Patibamba Baja, Abancay, Perú.

Leyenda: Figura 1. Fenotipos de alpacas Huacaya de color observados y registrados en Pacomarca.

Leyenda: Figura 2. Estructura 2D del gen MC1R. Los aminoácidos sombreados en coco (**) corresponde a sustituciones no sinónimas identificada en alpacas, en círculo y sombreado (*) corresponde a sustituciones no sinónimas reportada por Daverio et al. (2016) en llamas. I-VII son dominios transmembrana (TM), con extremo amino terminal extracelular ([H.sub.2]N) y extremo carboxilo terminal intracelular (-COOH).

Tabla 1. Promedio [+ ó -] desviación estándar de los valores de
intensidad, tonalidad y luminosidad en fibra de vicuña y alpaca
Huacaya cuantificadas por colorimetría usando Chroma Meter CR-210.

Especie    Color de        n    Intensidad   Tonalidad   Luminosidad
           vellón (1)

Vicuña     Canela          14   24.33        1.17        47.74
                                [+ ó -]      [+ ó -]     [+ ó -]
                                1.39 (a)     0.03 (a)    03.65 (a)

Alpaca     Marrón claro    22   16.60        0.97        29.85
           (MC)                 [+ ó -]      [+ ó -]     [+ ó -]
                                1.94 (b)     0.06 (ab)   03.78 (b)

Alpaca     Marrón oscuro   19   11.41        0.74        27.37
           (MO)                 [+ ó -]      [+ ó -]     [+ ó -]
                                4.42 (c)     0.54 (bc)   14.47 (b)

Alpaca     Marrón-negro    11   2.32         0.38        18.68
                                [+ ó -]      [+ ó -]     [+ ó -]
           (MN)                 1.55 (d)     0.28 (cd)   01.82 (c)

Alpaca     Negro           27   1.08         0.05        19.02
                                [+ ó -]      [+ ó -]     [+ ó -]
                                0.35 (d)     0.49 (d)    05.10 (c)

(1) Fenotipos determinados por evaluación visual.

* Letras diferentes en cada columna indican diferencias
estadísticas para los parámetros cuantificados que definen los
fenotipos. Prueba de Tukey, comparación múltiple de medias,
[alfa]=0.05.

Tabla 2. Genotipos identificados de los PNSs, con
presencia/ausencia de una deleción (c.224_227del) en la secuencia
codificante y las regiones no traducidas (5'UTR y 3'UTR) del gen
MC1R en 2 vicuñas y 79 alpacas Huacaya. Primera fila muestra los
PNSs, deleción heterocigota de 4pb ([-D.sub.4]) y sin deleción
(--), en negrita se muestran los PNSs no sinónimos. Segunda fila
muestra las sustituciones de aminoácidos, que incluye un marco
abierto de lectura (ORF) debido a la deleción (c.224_227del).
Última columna muestra la cantidad de animales con sus respectivos
fenotipos de color, 22 marrón claros (MC), 19 marrón oscuros
(MO), 11 marrón-negros (MN) y 27 negros.

C.-20>G    c.82A>G   C.126>T   c.224_227del   c.259G>A   C.354>T
5'UTR      P.T28A    P.D42D        ORF         P.M87V    P.N118N

G/G          G/G       C/C          --          G/G        C/C
G/G          G/G       C/C          --          G/G        C/C
G/G          G/G       C/C          --          G/G        C/T
C/G          A/G       C/T          --          G/A        C/T
C/C          A/A       T/T      _[D.sub.4]      G/A        T/T
C/C          A/A       T/T          --          A/A        T/T
C/G          A/G       C/T          --          G/A        T/T
C/G          A/G       C/T          --          G/A        C/T
C/C          A/A       T/T          --          G/A        T/T
C/G          A/G       C/T          --          G/A        C/T
C/G          A/G       C/T          --          G/G        C/T
C/C          A/A       T/T          --          A/A        T/T
C/G          A/G       C/T          --          G/G        C/T
C/C          A/A       T/T      _[D.sub.4]      G/A        T/T
C/C          A/A       T/T          --          G/A        T/T
C/G          A/G       C/T          --          A/A        C/T
C/C          A/A       T/T          --          A/A        T/T
C/G          A/G       C/T          --          G/A        C/T
C/G          A/G       C/T          --          G/A        C/T
C/G          A/G       C/T          --          G/A        T/T
C/C          A/A       T/T          --          G/A        T/T
C/G          A/G       C/T          --          G/A        C/T
C/G          A/G       C/T          --          G/A        T/T
C/C          A/A       T/T          --          A/A        T/T
C/C          A/A       T/T      _[D.sub.4]      A/A        T/T
C/C          A/A       T/T      _[D.sub.4]      G/A        T/T
C/G          A/G       C/T          --          G/A        C/T
C/G          A/G       C/T          --          G/A        C/T

C.-20>G    c.376G>A   c.587T>C   618G>A    C.901C>T   c.933A>G
5'UTR      P.S126G    P.F196S    P.L206L   P.R301C    P.E311E

G/G          G/G        T/T        A/A       C/C        A/A
G/G          G/G        T/T        A/A       C/T        A/A
G/G          G/G        T/C        A/A       C/C        A/A
C/G          G/A        T/T        G/A       C/T        A/G
C/C          G/A        T/T        G/G       C/C        G/G
C/C          A/A        T/T        G/G       C/C        G/G
C/G          G/A        T/C        G/A       C/C        A/G
C/G          G/A        T/T        G/A       C/C        A/G
C/C          G/A        T/T        G/G       C/C        G/G
C/G          G/A        T/T        G/A       C/T        A/G
C/G          G/G        T/T        G/A       C/T        A/G
C/C          A/A        T/T        G/G       C/C        G/G
C/G          G/G        T/T        G/G       C/C        G/G
C/C          G/A        T/T        G/G       C/C        G/G
C/C          G/A        T/T        G/G       C/C        G/G
C/G          G/A        T/T        G/G       C/T        A/G
C/C          A/A        T/T        G/G       C/C        G/G
C/G          G/A        T/T        G/A       C/C        A/G
C/G          A/A        T/T        G/A       C/T        G/G
C/G          G/A        T/C        G/A       C/C        A/G
C/C          G/A        T/T        G/G       C/C        G/G
C/G          G/A        T/T        G/A       C/T        A/G
C/G          G/A        T/C        G/A       C/C        A/G
C/C          A/A        T/T        G/G       C/C        G/G
C/C          A/A        T/T        G/G       C/C        G/G
C/C          G/A        T/T        G/G       C/C        G/G
C/G          G/A        T/T        G/A       C/T        A/G
C/G          G/A        T/T        G/A       C/C        A/G

C.-20>G    c.*5T>C    Cantidad de
5'UTR       3'UTR    cada fenotipo

G/G          C/C       2 vicuñas
G/G          C/C         2 MC
G/G          C/C         1 MC
C/G          T/C         2 MC
C/C          T/T         5 MC
C/C          T/T         3 MC
C/G          T/C         7 MC
C/G          T/C         1 MC
C/C          T/T         1 MC
C/G          T/C         5 MO
C/G          T/C         2 MO
C/C          T/T         7 MO
C/G          T/T         1 MO
C/C          T/T         3 MO
C/C          T/T         1 MO
C/G          T/C         1 MN
C/C          T/T         1 MN
C/G          T/C         1 MN
C/G          T/C         1 MN
C/G          T/C         1 MN
C/C          T/T         1 MN
C/G          T/C         4 MN
C/G          T/C         1 MN
C/C          T/T       9 negros
C/C          T/T        1 negro
C/C          T/T       9 negros
C/G          T/C       6 negros
C/G          T/C       2 negros

Tabla 3. Definición de ocho haplotipos con sus frecuencias en el
gen MC1R de 2 vicuñas y 79 alpacas Huacaya de color.

Haplotipos (H)     Frecuencia     82A>G    259G>A   376G>A    587T>C
[Número de        de haplotipos   (T28A)   (M87V)   (S126G)   (F196S)
haplotipos]

H1 [94]               0.580         A        A         A         T
H2 [22]               0.136         A        G         G         T
H3 [21]               0.130         G        G         G         T
H4 [12]               0.074         G        G         G         T
H5 [10]               0.062         G        G         G         C
H6 [1]                0.006         G        A         G         T
H7 [1]                0.006         A        G         G         T
H8 [1]                0.006         G        G         A         T

Haplotipos (H)    901C>T
[Número de        (R301C)
haplotipos]

H1 [94]              C
H2 [22]              C
H3 [21]              T
H4 [12]              C
H5 [10]              C
H6 [1]               T
H7 [1]               T
H8 [1]               T

* Primera fila muestra los PNSs no sinónimos elegidos para
construir los haplotipos y entre paréntesis se muestran las
sustituciones de aminoácidos, respectivamente.

Source Citation

Source Citation   

Gale Document Number: GALE|A656303889