Improved tagmentation-based whole-genome bisulfite sequencing for input DNA from less than 100 mammalian cells

Citation metadata

From: Epigenomics(Vol. 7, Issue 1)
Publisher: Future Medicine Ltd.
Document Type: Report
Length: 5,349 words
Lexile Measure: 1620L

Document controls

Main content

Article Preview :

Author(s): Hanlin Lu aff1 , Zhimei Yuan aff1 , Tao Tan aff2 , Junwen Wang aff1 , Juyong Zhang aff1 , Hui-Juan Luo aff1 , Yudong Xia aff1 , Weizhi Ji aff2 , Fei Gao [*] aff1

Keywords:

DNA methylation; T-WGBS; Tn5 transposase; WGBS

As one of the most important epigenetic modifications, DNA methylation plays a critical role in regulating gene transcription for a wide variety of biological processes, including embryonic development, cellular differentiation, repression of transposable elements [1,2 ], as well as a variety of diseases in mammals [3 ]. Recent achievements of ENCODE and FANTOM5 projects for mammalian genome annotation revealed an enormous diversity of mammalian gene transcripts. A large number of TSSs and promoters were discovered in noncoding regulatory elements of a genome, which were closely regulated by DNA methylation [ 4,5 ]. Especially, the cost of sequencing decreases fast along with technology upgrade, whole-genome bisulfite sequencing (WGBS) for genome-scale methylated cytosine (5mC) detection is now becoming much more affordable and represents an essential choice in future studies on DNA methylomes.

A major drawback in WGBS technology is that the DNA loss during multiple enzymatic and cleaning steps is based on chemistry ligation and the DNA degradation during bisulfite conversion. Therefore, relatively high amount of input material, in other words, a minimum of 200-500 ng and up to 5 µg of human input DNA, is mostly required for WGBS library construction. Many efforts have been made to develop techniques to reduce input requirement, including Post-Bisulfite Adaptor Tagging (PBAT) [6 ], tagmentation-based WGBS (T-WGBS) [7,8 ] and the commercially available Ovation Methyl-seq platform [22 ], which all claim to require only very small amounts of genomic input DNA to address all CG sites in a genome. Among these methods, Ovation Methyl-seq platform requires only 1 ng of input DNA to generate highly complex bisulfite sequencing libraries. However, it is not readily available for most labs. On the other hand, T-WGBS takes advantage of a hyperactive Tn5 transposase that fragments genomic DNA and attaches sequencing adapters in a single step, requires 10 ng of input DNA to reach a complex library.

Despite the technical advancement of WGBS, the needs for studies using ultra-low-input DNA amounts are also inevitable, especially for studies on pre-implantation embryos, cancer stem cells or tiny biopsy specimens in humans. However, if less than 5 ng input DNA was used for WGBS, previous studies were accomplished at the expense of genomic coverage [7,9 ]. Here, we describe an alternative T-WGBS approach that requires minimally 0.5 ng initial genomic DNA to achieve a successful library construction. This new approach retains the advantages of transposase-based library preparation allowing genome fragmentation and adaptor incorporation in a single tagmentation reaction. A genomic coverage of [greater than or equal to]82% for a library constructed from 0.5 ng initial genomic DNA can be achieved, thereby a high complexity of sequencing library is guaranteed.

Methods

T-WGBS library construction & sequencing

The 5'-phosphorylated reverse compliment of a 19-bp sequence (5'-Phos-CTGTCTCTTATACACATCT-3') was annealed to the two adaptor sequences (A1: 5'-GAT[5mC]TA[5mC]A[5mC]G[5mC][5mC]T[5mC][5mC][5mC]T[5mC]G[5mC]G[5mC][5mC]AT[5mC]AGAGATGTGTATAAGAGACAG-3', and A2: 5'-GAT[5mC]GGT[5mC]TG[5mC][5mC]TTG[5mC][5mC]AG[5mC][5mC][5mC]G[5mC]T[5mC]AGAGATGTGTATAAGAGACAG -3') by incubating 10...

Source Citation

Source Citation   

Gale Document Number: GALE|A409374823